>rJMCP018F07 246 bp,:Filtered
GGAGGCCATCTTTCGGAGCCTCAATGATCTGCCACGTAGGGTCCGTGCCTTGCTGATACA
TGATGATGTGCCCTATGTGTTTTTTGATATTGATGATCCCCCCTGATTGTACTTGTACTT
TTGCTCGTTCAGATGGAAATATGGAAAAAAGGAAAAACAGAAAAAAGAGAAAGAAGAAAA
AGAAAGAAGGGAAAATAAGTC