>JMCP018F01 313 bp,:Filtered
AAGGAAAGTGCGAGGAAGGGTATGATTTGAACTCTACCAATTGTAACAGGTAATAAGCGA
GAAGACAAGCTAGTTTCATGTCCAAGGTTCAGTGTATTTGAGTAGCTTAGCTAGCAACTT
ATATAAATCTTTGTTGGGACTCTTATTAGGAAATTAATTGGGGCTAGATTTTACTACGAT
GCCTTGGAGTGCCATTTTTGTCAACAAGGGACACGTTAGGCCATGGAAGTCATGTTGTGT
CAACGACGGCTATTTCAGTAATTAAAATCGTGTCATACTATCGTTTC