>JMCP018C11 630 bp,
TTATTCACTCTCTCTCTCATATCTCATACATATGATTTGTGGATAAAAACAAGTCAGAAT
ATATATAAATAATACCATTCAGCCATGCTAGCTAGCTCAGCTCGAAGGGTCTTATATGCA
TATTTCTGGTTTATCTTATCTTCTACTCTCTTTCAGCTCAGGTTTCTGTTCATTATTACT
CCATCTTCGTTCTGATCTAGTACGTTGTAGCTAGCCATGGCGGGCGGGCAAGGTCTGAAC
AAGCCATGCATTCTCCTCATAGTGATAGCGGGGATGGAGAGGTTCACGTTCAAAGGCGTG
GCGGCGAATTTGGTGACGTATCTCACGGATGTGGCGAAGATGAGCAACTCGTCGGCGGCG
AAGCTGGTCAACAATTGGTGTGGCTTCACCTCTATGGTGCCGCTGCTGGTGGCGCCGTTG
GCCGACTCTTACTTGGATAGCTATTCAACTATTTTAGGCTCTGCATTTTTCTATATTCTG
GGGCTGATAGCGTTGACATCAACGGCGATGGGGTGGCCGCCGGGGAGTAATAATGCCCag
AAAATTAGCTCTTCTTCCCTCTCATGGCCGCTCCACTTAATTTCACTGGGCCTGGG