>JMCP018C05 344 bp,:Filtered
GCAGAGTTCATGCAGACTTACATCGGGGGAGTTTCGTGCCCATACATATGCTCCAAGAGG
CTGGACCATGGTGTCCTGTTGGTGGGTTATGGTTCAGCAGGCTACGCTCCCATCCGGTTG
AAAGAAAAACCATATTGGATCATCAAGAACTCGTGGGGCGAGAGCTGGGGAGAGAAGGGA
TACTACAAGATCTGCCGGGGTCGCAATATCTGTGGAGTGGACTCCATGGTTTCTACTGTT
GCAGCTGTTAACACCCCCACTTCAGACTAGCAGGACAGGACACGTTCTGTAAAGTAGTTC
TGTAAGATATTGTTTGTTTGCAAGCGTCTCACAGAGAGCCACAG