>JMCP018B11 345 bp,:Filtered
GCAGAGTCACCATTGCAGCCGGCGGTGTTCTTCCCAACATAAACCCGGTTCTGCTCCCGA
AGAAAGCCGCTGCGAGCGAGGAAAAGGCTTCACAAAAAACTCCCAAGTCTCCCAAGAAGG
CTTAAATTACTGGTTTAACTTCGTTAATGTAAATGGGCCATGGGATAATGGGATATGGAT
TGGGCTGTCTAATCTCTGGTTAGCTTTTGATCTCTAATAGGGATGTTTATGTAGCGTTAG
ATAAGTAGTAATCGCAGCAGCGTTTGGTAGTATCAAAAATGAAAAATGTACTTGTTTTAA
GGATGTACTAAGTGCCTTAATTTATTTTGGTTTATTAACATGGTT