>rJMCP018B01 224 bp,:Filtered
GCACTACGTCAACTCTCCGAATGCTAGAAAGGTCGCTAGCTCTTGCGGCGTCTCTATCCC
CTCCTGTTAATTATAGTTCTATATATACCAATACTGTACTGTGTAGTGCATACGGTACAG
AGAATAATATGAAATAATATGCCTTGTTTGGCTCTTTTGATCATTGAATAAAGAGTGATG
AGCTCGTTTCGTAC