>JMCP018A09 437 bp,:Filtered
ATACAGTGATGCCTATACACTGTTTAAGAAGAATGCATCAAAACCTGAATGATTGCTTCA
TAGTCGGAACTGTGATCTATGTTCATGGGGAAGGCAGGTGGTTACTTTTCCCCAAACCGG
GAAAGCGAAAAGCGGATTATGTGAAGACTGAAGTGCATCAGAGAAACGCGTTTTTAATGA
ACTTACCGAAGTCAAGTTTGAATAAATTCATGCATTCATTCTGTTCAATGTCAAATTGAG
CAGCGATGTTCAATATCTATGCAAGGGGCTTGCAGATCTGGCTACATTCCTGTTGTTTTC
GTTTTCGTTTCTAGTTGATTGCTTTGCATGTAGAATAGAATGCAGATTGTAGAAAACTCA
AATGTGCTTATGTGAAATATATATATATATATGTAAGGATATTGGTTTCTTAGTTTGAC