>JMCP017H07 636 bp,
GCAGAGTGACCCCCGGCCGGAAACGCTAGCCTTCTGTTTATTCCAACCAAACGGCGGCAG
ATACGACGCCGGCTCAAAGATAACGTACATGAACATGTTCGACGCGCAGTTGGGCGCCGT
CAGGACGGCGTTAAACGCGATGGGGTTCAAGGGAGTGGAGATTGCGGTGGCGGAAACGGG
GTGGCCGTACAAGGGAGACAGCAATGAGGTTGGTCCCAGCGTTGACAACGCCAAGGCCTA
CGTTGGCAACCTCGTTTCTCACCTGAGGTCCATGGTCGGAACTCCATTGATGCCGGGAAA
ATCAGTGGACACCTATCTGTTCGCATTGTACGACGAGGATCTGAAGCCCGGACCAACGTC
CGAGAGATCCTTCGGTCTCTATAACACCGATTTAACCATGACCTATGATGCTGGACTTTC
AAAATCATCCACCCAGACTCCGACGACGCCAAAGAGTGCTCCGGCGATCGGTCCTCCGGC
GTCAAAGAAGAATAGTAGCTGGTGGTGCGTGCCCAAGGGTGGGGTATCAGATGCCCAGTT
GCAAGCAAATCTAGATTATGCTTGTGCACTACAAGGAATTGATTGTaGCCCAATCCAGCC
CggaggggccTGTtTcgagccCAACACAATCGCATC