>rJMCP017G05 656 bp,
TGAAAAGGGGCAAAAAGTTCTAACAGCAAGCAGCCCATAGTTACAACCACCTTGTTTTTC
GCAAATGTAATAAATTATGGCTTTCCATTGTAAGCTATTGAATATGCTAAATGAGAGCCA
ATTTAGGGAGAAGAAGATAAATTCCCAAGTACAAACTAACACAGTATCTTGTACACTCTA
AGCATAGATGGCCTAGTTGTCATTCATGGAAATCTAGGAACTCAAACTAATACTCCGTAT
TAAGATAACGTGACAATCTTTTTCCTAAATCAGATTAAGTAGTAAAGATACATGACGCAG
TATACTTCATTGAGCTTCAGTGTACAAAATAACATCAGATAAACTAAAGTTTCTTAAATA
TATTCATAACAGTGGAAGGCTTTAGTCAAAACCGAGATCATATAACGAAATTAATGACAT
GTTCACTACAAGATTCATATGCATGCAAATGCACCTTTTTCACCTTTTCTTCAAAGCAGT
TAACTAAAAATTGTTAATTTTGTTTTACAGTCAGCATATTACATGGTAGCACAGGGTAAA
ACAAAGATCTTACCTGGAAAGCAAAGGTACATATTCCAGCAGCAGGACTTGCAAATAGAC
CAAATGCAAAA