>rJMCP017G04 650 bp,
GAGCTCGACGTTAGTGCTGATGGTCCGGCCATTGAGGCGGCCGTTCAGAGGGCTTGGGAT
GCATTTGGGCGGATCGACGCACTGATTAACAATGCCGGCGTTAGAGGTCGAGTACACACT
CCATTGGATCTAACAGAGGAAGAGTGGAATGATCTCACAAAAACAAACCTAACTGGCACA
TGGTTGGTCTCGAAATATGTTTGCTTGCGCATGTGTAACGCTAAGTTTGGAGGATCTATC
GTCAACATCTCTTCCATTTCTGGACTTAACCGTGGGCAGTTGCCAGGAGGCCTTGCCTAT
ACTACTTCAAAGACTGCTGTTAACGCACTCACAAGGGTGATGGCACTTGAATTAGGAACA
AACAAGATAAGAGTGAACTCCATATCGCCAGGGCTCTTCAAATCCGAGATAACGGATGGC
CTCATGCAGAAAGATTGGCTCAATAAGGTTGCTCTCAGGACTGTACCTTTGAGAACATTT
GGCACGTCAAATCCTGCACTGACGTCACTTGTACGTTACTTAATCCACGACTCCTCTGaa
TATATTTCTGGAAATACTTACATAGTTGACGCTGGAAATACActGcctggtgTGCCTATC
TTCTcCTCTCTTTG