>JMCP017G03 213 bp,:Filtered
AGGAGATAAACAACTCAAACCCTAAATTCAATTTATGGATTTATATGCAACAAAAGAGCT
GCAATCTTGTAAATCCATTGACAATTCACAAAACATCAGCTGAAATCATGGAGAAAACGG
AGAAGATGAGTGAAATGTGAAGATTAAAACAAAAATTCTTTAAAAACAATCTAATTTCAG
AGAAGAAACT