>JMCP017F11 591 bp,:Filtered
TCATCTGCAACCAAATCCGCAACCAAATCCAACCACCAATGTGAGCATATAGTCATGCAA
TCCAACTATCAGCTTAAGCTTTTAGTTGAGATGGAACACATGCTTCGATTACCAAAAACA
TCTCAAATTTCTAATAATAATGAGAAACATTAAAATCACTGAACAGAGTAGAAAGAACAT
CATTAAACATAGGGAATATAATTTTGGAGAATTAATTAAGCACCTGCGGTGGTTGGACAG
ATGGACATCAAAGCACCCAAGGAATCAGAGCTACCAAGTGATCTCTTCATGGCTATAATT
GATCAGTGAAGTATGTAGTACCAAGTGGTTCCACTTCTTGAACACAGTTTTACAAATTTA
GATCAGATCAGGTCACCCCTTATATATACATATAATATAATATGCTTTTTGCTTGGATTC
TTTAGGTGTTTAGAAGTACAGCAAACTAAAAGACTCCATCTTTTTACAGAGAAAAAAGAA
GACGACACTATAGTGTGGAATTATGGAAGCCATTTTTGTCTCCTTCGAGTACAAAAAACT
CCATCTTTGTGCTACTTCATCC