>rJMCP017F04 644 bp,
ATGTCTGTCCTGAAGAGGTGCCCAAATTCGAGGGACCTGAAACTCCAGGAAATATCTCAG
CTCTTCAAGTTGAGGCTTGTCTGCAAACAACGATATCAGAGTAAATAGCCGCCAATGTAA
CAGTTGCTTAGTGTTTCGATGGAATAAAAAAGGGGGAGAACGGACTTCTGTGTTACAATA
TCCTTACATTCAAGATaGAGACTTATAGCACGAGACAAATGCTCCTTTCCTTTAACTCCC
TCGAGGAGCATTGTAATCGGATAGAATGACATCTCGATGACATCGGGTGAAGACTTGACT
GTTTTTGCCCAATGGACGTGGCTTTGCTCCAGGTCGTCTCCTCCCCTTCTTCTGAAAATG
ACTGTAACGTCCTGCATTAGATCCATCAAAAAATTTCAGCCTAACAGCAGGAAAGAAACT
TTTAGTTTCCATTAAGTCACTGCACTTAGTTAATAACATAATTATATACCAAGTCACATG
CATTTCGTTTTTTGTTGTCAGACCACGAGGTGTCCTGAGCAGGTCCTAACTGTAGGAGAC
ACCTTTAAGCCCGTACCATACTCAACTAATCCCCGTTCGCACCGGGCCGGCCCAATTAAG