>JMCP017E07 626 bp,
ACTTTATCTAACTCCcaaTCTCTCTCTCTTTTTCTCTCTTTCTCAAAAACCAATGGCCCC
TAAGGCGGAAAAGAAGCCGGCTGAGAAGAAGCCCGCGGCGGAGAAGGCTGCCGCAGCCGA
GAAGGCTCCGGCGGAGAAGAAGCCGAAGGCCGGCAAGAAGCTCCCAAAGGACGGCGCAGC
AGCGGCCGGAGACAAGAAGAAGAAGAGGACGAAGAAGTCGACTGAGACCTACAAGATCTA
CATCTTCAAGGTGCTGAAGCAGGTTCATCCGGACATTGGAATCTCCAGCAAGGCCATGGG
GATCATGAACAGCTTCATCAACGACATCTTCGAGAAGCTCGCCCAGGAGGCCTCTCGTTT
GGCTCGGTACAACAAGAAGCCGACCATCACTTCCCGTGAGATTCAGACCGCCGTGAGACT
TGTCCTCCCTGGAGAGCTAGCCAAGCACGCCGTCTCTGAAGGCACCAAGGCCGTCACTAA
GTTCACCAGCTCTTAGGATGTTGAAAATTAGGGTTTCCAATTGTTCCTGGTTTGAATTAG
GTTTTATTGTaGATATAAAGTCGTTTCGATTTATCTCTGCTATGGACTGTAGTCTATTGT
ATGGAACCCTATTGAATCAATGAATC