>rJMCP017E06 582 bp,
GTGAAAGCTAAGGTGGAGATCGAGTATTACTAGCTAGAATCGCCGCTTTCACGCTAGTTT
TGTGAGTACACTCCTACACTATACTACAAGGCCAAGATCACACTTTTCCGTTTATTGTAA
TAGGCCAATAGTCCACGTTGCAAGAGATCTCCAAACCAGGAATACACTTGTCTATACATT
CATGCAAGATACGGGTATATTCTGCCTATACATATACATATACATATCAACTGATATACG
CAATGGAATTTGTATTGTTATATACTAAAAACATATACTTTCATGACAGTTCTTCACATG
GCCTGCATTTACTGAACGAAAAAGAAGGAAAAAAGGCAAACAAATTGTCTTTGGACAAAA
TATACTAACTAACACTCTTTTCTAGCCTTTGAACACATTTCATTATGTTTTTCCATTTTC
CAAATCGAACAAGTGTTAGTTTTTACAATAATACCCCTAAAACCCAATAATTAGTGCATA
CCCGGCGAGGCTAGCTCAAGTGGTAAACCATCTAGCATAAAGTCACCTCTTTAGTAAC