>rJMCP017D08 369 bp,:Filtered
CACCAAGGATGATGCCATGAAGTGGTTCCAGGTCAAATATGAAGGGGTTATCCTCAACAA
GGCCTCAAACATCTCATAAGTCCAATCTTAGTTTGAGAGAATTTTCAATCAGTTTGTATC
TCCTAGCAATTTTGTGTATTTGCCTTATTATAGACCTACATCTTACTCAGAGTTACTGAG
TTTTGGGTACCAGGATTTGTTGGTAAGTTTATCAAGGTTATCATGACATCTTTGCTGTCT
AATTTGATTGTGTGATTTATACTTGGGATCTAAATGGTTCTGTAGTTCTTCTGTCTAATG
TTATATTGCTTTCTATTAAATCCAAATACAAGTATAAACCC