>JMCP017D01 367 bp,:Filtered
AGGAGATAAACAACTCAAACCCTAAATTCAATTTATGGATTTATATGCAACAAAAGAGCT
GCAATCTTGTAAATCCATTGACAATTCACAAAACATCAGCTGAAATCATGGAGAAAACGG
AGAAGATGAGTGAAATGTGAAGATTAAAACAAAAATTCTTTAAAAACAATCTAATTTCAG
AGAAGAAACTGGAAAACAACAAATTAAAAATAAAAAAAGAAAATGAGAAAAATCTCGCAG
TGACTGAAGAAAGGAAAAGTGTTGTTGAGAGATAGAAGTAAAGGTGTCAGCTGAGTGTTT
ATATATATATATATATATATTATAAAATAAATTCCCG