>JMCP017C02 470 bp,:Filtered
CTGCGCTGCGAGCCTGAagaTTTGACGGtAGGAGCGAAGCTGTGGCGAgaaCGTGAGAGa
GATGACaaGGGGAAAGCAAAAGATCGAAgcGCagaGAAAAAACGCGGAGAAGAATCAGAA
GGGCAAAGGGTCTCAGATCGAAGCCCGAGCTGTTGGCCTCAAAGTCATCTGCCCCATCTG
CAAGGCACAACTAGCCAACCAGAATCAGCTTGTGGATCATTATGGATCAAAACATCCAAA
AGAAAAGCCCCCAAGCAACTCGGGATGATGTGGTATTGCTGATGAAGATGCATGCTCTCG
TCTCTGAACTTGCCAGTTTGAGTGAATGAATACAGTTGTTGATGGTTGAGTGGTCTGAAC
GAAGTTTGACTTTTTCTACTTATAGTGACTATATTATAGTGACTATGCGAAAGGACAGAT
GTTTGTGACTATTTGATATCAATAATTATGGAAAAAAAAGATCTTGTTTT