>JMCP017B09 447 bp,:Filtered
AACGCAGAGTTCATGCAGACTTACATCGGGGGAGTTTCGTGCCCATACATATGCTCCAAG
AGGCTGGACCATGGTGTCCTGTTGGTGGGTTATGGTTCAGCAGGCTATGCTCCCATCCGG
TTGAAAGAAAAACCATATTGGATCATCAAGAACTCGTGGGGCGAGAGCTGGGGAGAGAAG
GGATACTACAAGATCTGCCGGGGTCGCAATATCTGTGGAGTGGACTCCATGGTTTCTACT
GTTGCAGCTGTTAACACCCCCACTTCAGACTAGCAGGACAGGACACGTTCTGTAAAGTAG
TTCTGTAAGATATTGTTTGTTTGCAAGCGTCTCACAGAGAGCCACACAAAACAACATACT
ATGCAAGTGTATTCATTATTAGATTTCATCAATCTATTTCTCAATTTCGTCAACTCTGAA
ATACAGTTCATGCAATTGTTCTGTGTC