>rJMCP016H04 645 bp,
TTCATCGTCGGCCTGGAagaTaATCCGAAAGCATAACAAGTTTCGctgCGTCAATTCGGA
GGTGCGGTCatGGCTGAAGAGGAAATCCAGAACGAGATGAAGGAGGAGGTTGCAgaTATT
GCTCCAtTTGATCCTACAAAAAAGAAAAAGAAGAAGAAGGTTGTTATCCAGGATCCTGCA
GCAgaTGATTCTGTCGATAGCTTGGCTGAGAAAACTGAAAGTTTGACAGTTTCAGATGGT
CTTGAGACAGCAtTTTCTGGCAAAAAGAAGAAGAAGAAGCCTGTACACACTGATCTCTTG
AATGATGAGATGGATAATACAGGGGACGATATAGATGATCACTTcGGAGATGATGAAGAA
GCTGAAGAAATTGTTCTCCATCGCTATCCATGGGAAGGAAGTGACAGGGATTATGAATAT
GAGGAGCTTCTAGGTCGTGTTTTCAATATCCTTCGTGAAAATAATCCCGAGCTTGCTGGA
GACAGGCGTAGAACAGTAATGAGGCCTCCTCAAGTCCTTCGTGAAGGCACAAAGAAGACT
GTCTTTGTTAATTTCATGGATCTTTGCAAGACGATGCATAGGCAGCCAGAGCATGTCATG
ACTTTCTTGCTGGCTGAAATGGG