>JMCP016E08 657 bp,
GACCACAATCAATTTGCTATCTTTGCCACCCCATTGCATCCTTTCTCTTCTCCATCTTCT
CTTTCAACCACCTGAAATGGCCACTGCTGAGGTTGAATCAGTTCCGGCAACAGTGACAGA
GGATGTTGTAGCTGAGGTGAACACAACCACTGAGGCTCCAAAGGCAGAAGAGGTGGCTCC
ACCTGCAGCTGCTGCTGATGAACAACCTGCAGAGACAAAGGAAGAAGGAGCATCAGAAAC
TACAGCACAAGAAGTGGCAGCTCCGGTAGCTGAAGAGGCTGAGACCAAGGAAGTGGCGGC
GGAATCTGGAGCTCCGGCAGCAGAGCCTGCAGCTTCTGAAGAAGCTAAGGCAGAAGAGGG
TGTTGCAGAGGAAGTACCTAAAGAAGAAACTCCTGCTGAGGTTGCTGAGACCACGGCGGA
GGAAACTGCAGCGGCGGTGGCTCCTCCTGCTGCTGAGACTGTGGTGGAATCTGCTGCTGA
CTCTGAAGTTCCAGTGGAAAAGGCTGAGTAGATTCAGAGTTAAGGTACAGTGGTGAATGA
AAGTGGAAAAAAGTGGGATGCTTCATGGGGAGTGGGGACTTTTAGACTTTGAATGCCTTT
ATTTTTCTTTTT