>rJMCP016E07 340 bp,:Filtered
ATGGCTGGGTGCATGTCTTGTCTGGCCGAGATTAAGGCAAAGAAGTGGGGTTGCCCCGTC
TGTCGTGCCAAGATTGATCAAGTGATAAGGGTATATGCTGTTTAATTGTTTCGAGAGGAA
GCAATGGAACAAGTATATGTGGAAGAGCTACGATTGCgAGTTATCTTTGGTCTAAGAAGT
ATACTTTCACGGGGTAAAATTTATACTATTGCAATGTAATATCATACTAGAACTGCAGCA
AATTGTCATTCAATGTGATTGTGGTATTGTTTTTATTTTGAAGGGGAAAAAGAAAGTGAA
TATAG