>rJMCP016E04 223 bp,:Filtered
TTCATCATCCCTTGAGACAAACATATTTGGGTCAATTACATGGACTAGCGGAAAATATAA
AGTTAGAAGTCCAATCGTTGTAAATGTTGAGTAAGGGAGTCAATCAGTTAAAGCGACAAA
TTGTTAGACATGTGACTAACTTGAGGCAGACCAGTATGAAAATCAAACATGTTTTGATGT
TG