>JMCP016D07 409 bp,:Filtered
GGGTTGCATCCTACTTCTACTGATGCTGTTTACATGCAGTGGCCTACCCAGTCCATGATG
TATGCTCATTCATATGAGGAACTTCGACATGGTGTTTTCCAGGTCCCATTCTCTCAGCAA
CCCCTCAGTTTTGATTACTCACAAAACCATTGCTGATGGGTAGAATTTGATGGAAAATAT
CTAGTGAAAGCAGGTTTTCCCTCCTTTATAGTGTTATCCTAATTTAGGCTAATTGTTTAA
GACCTATGAACTTGGTGTTATAGTATCTTTTGTTTTCATTTTTCGAAATTATCGCAAGGA
GGTGATCACTGTAGCACAGAGTACTTGCTATTATTATTTGTAGTGGAACTTCCCGCATGC
CTCTAC