>JMCP016D01 153 bp,:Filtered
TTCCATTACAGCCTGCAGCATTCGCaTGTTCAAACAAATTTATTTTTTGTTTTTTTTTAA
AACCTTAGTAAATGTGAATTTGAATGTACTATATATGGTTTCTACCTTGTAATCTTTTAT
TTT