>rJMCP016B12 655 bp,
GGATCTCTATGATTCTATTGCTGCTGGAAACTATCCTGAATGGAAGCTTTTTATTCAAAC
AATTGATCCTGACCATGAGGATAGGTTTGACTTTGATCCACTAGACGTTACCAAGACCTG
GCCCGAGGACATCCTGCCCCTGCAGCCTGTGGGTCGCTTGGTTTTGAATAAGAATATTGA
CAACTTCTTTGCAGAGAATGAGCAGCTTGCATTTTGCCCAGCCATTGTGGTTCCTGGGGT
CTATTATTCAGATGATAAGCTCCTCCAAACCCGAGTGTTCTCTTATGCTGATACTCAGCG
ACATCGTCTTGGTCCAAACTATCTACAGCTTCCTGTTAACGCTCCCGAGTGTGCTCATCA
CAACAATCACCATGATGGTTTTATGAATTTCATGCATAGAGACGAAGAGGTTAACTATTT
CCCATCAAGGTATGATCCTTGTCGTCATGCTGAGCAGTACCCCATCCCTCCACGTATCTT
GACAGGAAAGCGTGACAGGTGCATCATTGAGAAGGAGAACAACTTCAAACAACCTGGTGA
GAGATACAGGTCCTGGTCACCAGACAGGCAAGAAAGGTTTGTGTGTCGATGGGTTGATGC
TTTGTCTGAT