>rJMCP016B08 530 bp,:Filtered
ATTTACTCGGCCGGAAGCAATCGGGTAGCTTCGTCTATAATTGCGCCGTGATGGGTTGCT
AAAAAACGTGGTTCTTTGGGTGCTCTTGCTAATGGGTAATCTATCCCGACCTTTATTTTC
TTTTTTATTCAGTGCATTATTTTTTTTTCCTTTTCTCTGTGGGAGGATATAGGGAGGAAT
TATCAACCGACTCAAGATTTGACCGCATATTTCTTCTAAAGGAGTTGTTGAGTATCAAAT
TTTTTCTGCTTCGACATTTTCATTCATATTGAATGATCTTCCCCCATTTGGTTAACATGA
AATCTTCAAAGGAGGCCAGCAAAAAATAGCAAAGGGATAGGAAAATAACTTCGAGGGTGG
GAGCAATACAATACTagaAATCTCCGATTaGTTTTCGTTGAAGCTTCTCCAAGAAATTGT
agaGCTTaGTTCTCCATTAATGTTCGCTCTTTTCTCTTCCCCCACCTCTCTTTATTTTTG
TCATAGTCGAGAAAACCC