>JMCP016B04 311 bp,:Filtered
CCGGACTCCGACTGTACGGCTCAAACCGACAATCTAAGCTATTATGGCTTCTTCCATTTG
TTTGGCGAAAACGCGTACGGTACGCAGTGCAGACAAAACGGCAACGTTTGCAGTTGGCAC
TTACGCCACGACGGCTGTTATCTGTTGGTGCAGGGTAATGTGTACATCGTCAGAGGCTGG
ACTCTACACCCACCACTACTGTAATCTAATTCATGCATCACTTACGTTGTTTATTTAATT
TAATTTGCACCGTACCAACGCATGATCAAAATT