>JMCP016B02 657 bp,
GACATTAAAGAAACCAACAAAAATCTTTATCATTTCTCTTGATAACATTTTTTTTCTATA
TCATACCAATCCTTTGAAATGGGAAACACCCAGACAACCCCATCAGCCCCATCCTCCGCC
GCCAATCCCGCCACCGGAGAGTACAATGCTGCGTCCATCCCTCCCGGCGGCGTTATCACC
ATCCTTAGCATTGACGGAGGTGGCATCCGTGGCATCATCCCCGGCACCATTGTCGCTTAC
CTTGAAGAGGAGCTTCAAGCTTTGGACGGTCCGGATGCAAGAGCAGCGGACTACTTCGAT
GTGATTGCCGGAACGAGCCCGGAGGGCTGATGACCACCATGTTATCGGCGCCGGACAAGA
ACAAGCGCCCCCTCTACGCCGGCAAGGATATTGTCCCTTTCTACAAGGAGCACGGACCAA
AGATCTTCCCATCAGCAGGAATATTTGAGGTGGTGAGAGACGCAACCAGCCTGTTGGCCG
GTCCCAAGTACGACGGCAAATACCTTCACCAAGTCCTCCAGGACCAATTGGGAGAAACTC
GGTTGAGCCAAACTTTGACGCACATTGTCATCCCTGCCTTTGATATCAAGACCTTCCAAC
CCACAGTTTTCA