>rJMCP016B01 491 bp,:Filtered
AATTCCAAGATGGTATAAAAGCCTTTTCCGACAGTCCTATCATTGGAGAGATTcgaGGTC
TTGGCTTGATCCTTGGGACCGagTTTACTAACAACAAGtCTCCTAATGATCCTTTCCCTC
CTGAATGGGGTGTTGGTGCTTACTTCGGAGCTCAGTGTCAGAAAAAGGGGATGCTGGTCC
GTGTagcTGGCGATaaCATAATGATGTCTCCTCCGTTTATAATGACTCCCGAGGAagtTG
ATGAgttGAtCagtatAtAcggGGAGGCGTTGAGGGAGACCGAAAGgcgAgtagaaGaAC
TCAAATCCCagaagaAGTAAATTTGATGGTTACCAAAGCTCATTGCTATTCAAAACAAag
tGTAAAACATAAATAAGGATGTTGAGTagGAGgTTTCagcTTCTGCTTCTTCTGGATTGT
CCTTACTCTCTTTATGCTGGTTGTTGAACACTGAatgtagagTAAGGGAATAAACATTTT
ATTGTTATACT