>JMCP016A10 569 bp,
GACCACCCCGTACGGCGAAttcTtcCTCTCttgGTACTCCCAGaTGCTTCTGGACCATGG
CGAGAGGATACTACAATCagCCAACGCTATATTCGACAAcacGGGCGTCAAAATATCagt
GAAGATTGCCGGAATCCActGGCACTAcggCACCCGATCCCACGCCCCagaGCTCACCGC
CGGCTACTACAACACCCGTTTCCGAGACGGCTATCTCCCCATCGCCCAAATGCTCGCCCG
CCACGGCGCcaTCTTCAACtTcACCTGCATCGAGATGCGCGATCACgagcAGCCCCAggA
CGCCCAGTGCGCTCCCgagAAACTGGTCAGGCAAGTAGcCTTAGCCACCcaaGAAGCCCA
GGTTCCCCTTGCCGGGGAGAACGCGCTGCCACgatacgacgattacgCGCAcgaacagat
actcagaacTTCcgcATTgagcatcgacgaatagtcgGGTGATagagaAATGTGTGCGTT
CACCTACTTAagaatGaACCCagattTGTTCCAGGCTGAtaaCTGGAGAAGGTTTGTGGC
GTTCGTGAAGAAAATGAAGGAAGGTAAAG
>rJMCP016A10 395 bp,:Filtered
ATCAACACCCttcttcaaggatactccggcatcagatttgagatcttggaagccattAct
aaatTGctCAACCataacatcactccatgCctgCCTCTCcgtGGCACCATCACCGCCTCc
ggTGACCttgtgcctttatcctacatcgccggtTTGCTCACCGGCCGcCCTaATTCcaag
gcggTtggACCCAacggacaggcCCTCaccgcggaggaggcgtTCAAACTcgccggagtC
AAcgatgggttcttcgagttgcagcctaaggaagggcTTGcaCTTgtgaAtgGCACTGcT
gtgggtTctggcATggcGTCTATGgtcCTCTTTgaAGCTAATGTTcttgcggtgttgtcc
gaggttttgtctgCAATTTTcgCGGAGGTGATGAA