>rJMCP015H11 655 bp,
ACCCGTGAGCATGCTTTGCTTGCTttcaacctTGGTGTCAAGCAAATGATCTGCTGCTGT
AACAAGATAGATGCCACTACTCCCAAATACTCCAAGGCTAGATATGATGAAATTGTGAAG
GAAGTGTCATCCTACTTGAAGAAGGTTGGATACAACCCTGAGAAGATCCCATTTGTCCCA
ATCTCTGGTTTTGAGGGTGATAACATGATTGAAAGGTCCACCAACCTTGACTGGTACAAG
GGACCGACCCTCCTTGAAGCTCTTGATATGATTAATGAACCCAAGAGGCCCACTGACAAG
CCCCTCCGTCTCCCACTCCAAGATGTGTACAAAATTGGTGGTATTGGAACTGTCCCTGTG
GGTCGTGTGGAGACTGGTGTCCTCAAGCCTGGTATGGTTGTGACCTTCGGACCTTCTGGC
CTGACCACTGAAGTTAAGTCTGTTGAGATGCATCACGAAGCTCTTCAAGAGGCTCTTCCT
GGTGACAATGTTGGATTCAACGTGAAGAATGTTGCTGTGAAGGATCTCAAGCGTGGTTAC
GTTGCTTCCAACTCTAAggatgACCCAGCGAAAGGAGCTGCCAACTTCACCTcccaggTT
ATCATCATGAA