>JMCP015H08 195 bp,:Filtered
TCTTGGTCGTAGAAAACATAGGAAGGAATATAATTAATGTATACTCTCCTTAATTATTAT
TATTATTATGTAATAAATTTGCTAGCCTCCTTCCCTGCTCTGCTGTATTTTATTTGTTAC
TCATTCAAAGGAGTGAGTGCTGTAAGCTTGTAACATTATTTAACGTTGTAATTTATCG