>JMCP015H04 482 bp,:Filtered
GGGAGAAATGAGATGCAAAAGATACTTGAACATTTGGCACACTTGAAGTCTCCTTGGAAC
TGTCCGCATGGGAGACCAACGATGCGTCACTTGATTGACTTGACCACTGTACATAAAAGG
TTAGATCCAGATCCAACATTGTGAACCCTTTACTTGTGTTGTACTGATCCGACCTAAAAT
ACAAAAGGGGAATCGAATCAAGAAGGCTTGCAAAATGTTTTGTCCCGTAAGTTATGCACT
GCCACCAACTTATTTTGAACCCTGTGAAATAGGTGAAAATTTTGTATATACAATCAGTTT
TTGAGTTGCATGGATGTTATTGTAGTCTTTTTCAATGTAATCAGGTAAGAAAAGAGCCTG
CAACCCATTATCCGTTACATATTTTTCCTCCGTAACTCAACCGTGTGAATTCGGATATAT
TTAATGGGAAAAGTACTGATGAGCCTGTTAGATAGTTGT