>rJMCP015H03 645 bp,:mask_remained
ACTTACGAGAAGAATGGGAAGTCTGCTGAAATTCATTACGGGACTGGATCAATATCTGGT
TTCTTCAGCCAAGATAGCGTTCAAGTTGGTGATCTTGTTGTAAAAAGTCAGGCATTTATC
GAGGCAACAAGTGAGCCGGGTGTGACTTTTTTGGTTGCCAAGTTTGATGGCATATTGGGT
CTTGGATTCCAGGAGATCTCGGTTGGAGATGCXXXXXXXXXXXXXXXXXXCATGGTAAAC
CAAGGTTTAGTTCAGGACCCTATCTTCTCATTTTGGCTTAACCGAAACCCACAAGAGCAA
GAAGGGGGAGAACTTGTGTTCGGTGGGGTTGACCCGAAACACTACAAAGGGGAACACACC
TATGTTCCAGTGACACAGAAAGGTTATTGGCAGTTTGATATGGGTGAAGTCCTAATTGAG
GGTAAACCAACTGGGTTCTGCAGTGGTGGATGTTCTGCAATCGCAGATTCTGGAACTTCT
CTGATAGCTGGTCCATCGAGTATTATTACCATGATCAATCACGCCATTGGAGCTGATGGA
GTAGTTAGCAAGGAATGCAAAGCCGTGGTTGAAAACTATGGACAAAGAATGATTGATTTG
CTTGTAATGG