>JMCP015G05 644 bp,
GGGAGTAGGATTCTGCATCCAACCAAAAAGCTGTTTGCTTCTTTCTCTTTCGTCAGACGT
TAATGGTGAATCTGTGCTCTGCATAGTCGGTTCAGTGTATGCATACACAGGAAAAGCTAT
ACATACAGATGCATTGTTCTGAAGCTAGCTGGTTGATGCAAGATTACTTGTTGGATTTCT
TAGGAGTAAGACTTATTTTGGAAAAGAGTGAATTTGGCAGTACTCGCGGAGTTTTTGAAA
AGGCCTGAAGTATTTGAATTGGAAGGTGTGGTAGTTGGTGCGTTAGTTTTCTGAGGAGTG
ATTTTCTTTTCTGAATTCTGTTGTTGTGGTTAGAATGGGTGGTTGAAAGGATCAATTAAG
CTGGTTTATAGTTCAACTATTTAATTCATAGGGTGTAGCTGCTGAATTTATTGCAATTGA
TGAAAGCTTGGCTATTAGATTCTACCAATGCCAGTTGAAGTTGCTTGGGACTTGAATGAT
ATTTACGAGGGATTGTGCCTTACAATAGGTTGTAGCTTATGTGGACTTTGGAGGTTCAAG
TCAAAACAATAGCTAGTACGTGTGGAGTGCATCaGCTCAAATTAAAGGGGTCTGCAAAAT
CTGGTCATGAGAAG