>JMCP015F11 622 bp,
GATGCATATATTGGTGGAAAACGAATCAATCCTCCAGATGATAAATCACAATTGCCTCAG
AAGGTCATACCTCTACTCCTTGAAGGCATTGCACAGAATACAACTGGCAGTGTGTTTGTT
CCAGAGGGTGGAGTACCCGAGGTTTCTGGATCACCAACAGAGAAGGCCATTCTCCAGTTT
GGAGTCAAGCTTGGTTTGAATTTTGATGCCATTCGATCTGAGTCGTCAATTATCCATGCC
TTCCCATTCAACTCAGAGAAGAAGCGAGGTGGTGTTGCTGTGAAACTGGATTCTGAAGTT
CATATACATTGGAAAGGTGCTGCTGAGATTGTCCTATCTTGCTGTACACACTACATTGAT
GCAAATGATAATGTGGTGCCTCTGGATGAAAATGAGGCAATATCCTTCAAAAAGGCAATT
GAAGACATGGCTACTGAGAGTTTGCGTTGTGTGGCTGTTGCCTATGTGTCATATGACATG
GATAAAATTCCTAAAAGTGAAGAAGAATTGAGTCGATGGGAATTGCCAGAGGGAGACTTG
ATTTTACTTGCTATTCTTGGGATTAAGGATCCATGCCGaCCTGGTGTAAGAG