>JMCP015F03 511 bp,:Filtered
ATTTACTCGGCCGGAAGCAATCGGGTAGCTTCGTCTATAATTGCGCCGTGATGGGTTGCT
AAAAAACGTGGTTCTTTGGGTGCTCTTGCTAATGGGTAATCTATCCCGACCTTTATTTTC
TTTTTTATTCAGTGCATTATTTTTTTTTCCTTTTCTCTGTGGGAGGATATAGGGAGGAAT
TATCAACCGACTCAAGATTTGACCGCATATTTCTTCTAAAGGAGTTGTTGAGTATCAAAT
TTTTTCTGCTTCGACATTTTCATTCATATTGAATGATCTTCCCCCATTTGGTTAACATGA
AATCTTCAAAGGAGGCCAGCAAAAAATAGCAAAGGGATAGGAAAATAACTTCGAGGGTGG
GAGCAATACAATACTAGAAATCTCCGATTAGTTTTCGTTGAAGCTTCTCCAAGAAATTGT
AGAGCTTAGTTCTCCATTAATGTTCGCTCTTTTCTCTTCCCCCACCTCTCTTTATTTTTG
TCATAGTCGAGAAAACCC