>JMCP015E05 633 bp,
GGAAGAATTTCTCTCTCTCTCTCTCTCCCTCCCTCTCTCTATATATATATATATCTATTT
ATAGCTGAATCCCTCTCTGCTTTTCTCTTCTGCCGAGTTATGGGTTTGAGCCCacTGTAC
TCCCATgCtTATCACGTTATCATCGTCCTCACCACcacTTTCTTTCGCcaCAAGCTCTGA
ATcGAATCTCCATTTTTGCTCTCTGCTTATtACAGCCTTATATagcTTCTTCCTCTGCTG
AACCCAtTTTTCTcGTTCTCCTTCTGAGCTCTGCAACTTTTGAAAAGCTTCagaGCTAAA
TTGAgaAgcTATATATGGAGGgCACTGGGAagatgagTTCTTGTGTTGATAACAGAGtTC
TTCTTcaAAAcgaTAGATTTCCTTCCCCTTctgaggTTCTTGATTCCTTctGgctTCCCA
CCTctaaCCCTTCTTttcAaGCTTCTGCATCATCCATGGTGAATTTCAACGGCGGcggtG
GagaGATGGAACGCGGCGGTGGCAATGAGGACTATGgCggcGGTGGGTTCTATCaggcgg
agaagaagcGGCGGCtcagcccTgagcAAGTCCAcTTTCTGgagcaaagtTTTGaggTGG
AAAAC