>JMCP015D12 470 bp,:Filtered
GAGATGAAGAGGAAGAAGAGAATTGCGTCTTATAACACCTTCACTACTGAAGGTAAAGTT
AAGTCCACTGTTAGAGAAAGCTTCAAGTGGATCAAGACCAAACTCAACGATATTCGTTAT
GGCCTCTAGCTAGTCACCCTTAATCTCTCTCTCTCTCTCTATATATATAAATGTAATGTT
TTTCTTCTCGATCTTCTTCTTTTTTTCCTAATTAAGCTAAGGTTTCATTCCCTTCGATCC
TCATCGTATATTGTTTTTGTTTTTGATGATCGTATGAAACGAGAGACTGCGTCGGTGAAT
TTTACCTCATAGGGGTGTTTGGATATATCTACTGATGATGATCATTTTGAGTGGTTTAAT
TTGTGTTTCAACTCTTTTAATTTTGTTCCCAATGAATTGTAAGATACAATAATCAATCTT
ATCATTCAAGTAGATTTGGTG