>JMCP015D09 217 bp,:Filtered
GAAGATTCCTTCATAAATGCATCAATCTTTTTGTTTTGGACTGGTGATTCTTCTGAAGTT
CCAGAATCAAATGCAAATGTCGTATTTTTATTGTAGCAAAAAGTTACTGTTTGTTTAAAG
ACTGGAATCTTGAATATGTATCTTTCTGTTTTCTTCAAACACTTTCGATCTAGCAGTTGT
TTTCT