>JMCP015D03 612 bp,
GGTTTTTTTTTGTTAATCCATCCTCCAGCAATTAATGGAAATATCAAATATGAGTCCAAC
TTGATTTTGGGATCTCCCAAGTGTAATGCCACTTGAAAGTTTTGACGTTCACTTTGGTAC
GTACAACAATGAAAATCAGTATTATGTCAAGCTCTTCACGATACAGGAGGATGCTAAAGT
GATAGTGGTGTTCATTTGATGCCCTGGTTCTATCAACTACAACTACAACTACAACTAcAg
GAGGGAAGAagaGCTGTAATGTAATGCCAGAGAGCTAATTGGAATTATTGGACGTGGCCG
TTACAGGAATATGAAAAATGGAGCTTTTCCCCCCCTTATATATtaCCCTTTATTTGAGCT
TATGGGACCATGACAGCTAGTGCTTGAAGGGACAAATTATTTCAATTGCAAATTTAGTCA
AAATATAATTTAAAAAACAATTATAAAAGGAGAGAAAATACCTGGAAATTGGAAAAGAAA
AGAGGTTCCATGTTGGTTAGGATgtggAGGaaATGGGGCCCCATaGTcaCATCCTAAATT
ATTTCAAtTGCaaATTTAGTAaAAAtAATTT