>JMCP015D01 304 bp,:Filtered
AACCAGCAGCCAACGAGGTAAACTGTAACCCATAACCAGCAGCCACTGATGAAATCCAAT
TCTCTGGGTACTACTGTCTGTAGAGGATTGGTAATATTTCATTGTTCATTTTGCTGATGC
GCAATAAGGTTTGAGTGCAAGGCTCTGGTTTTTTTGTCGACAGTCTAGATTAGGAGGTTA
AAGTGTTTTGCTAGACAGTTTTGTTCAAACTTTAACATTGTGGTACTTGATGTGTATCAT
AGTAGCACTTTCTTTTCTAGTATATGTCAATTTTGGTTTGAATGC