>JMCP015C10 238 bp,:Filtered
GGCTCGAGGAATGAATAATTTAATTTATATACTTATTACTACAACAATAAATCCCAAGGG
CAAGGCAGATTATGCTATTTAATCTTAATTATCTCTACTTAATTACTTCTTATGATACGT
GTGATGATAAATAATATGTATAATGCATGTAGGCCTATATATGGCCACGTTCAATAATGT
GCAATTCAACTTTAATAATCCATTTGTGGT