>rJMCP015C06 532 bp,
TTCATCGTCGGCCTGGAAGATAATCCGAAAGCATAACAAGTTTCGCTGCGTCAATTCGGA
GGTGCGGTCATGGCTGAAGAGGAAATCCAGAACGAGATGAAGGAGGAGGTTGCAGATATT
GCTCCATTTGATCCTACAAAAAAGAAAAAGAAGAAGAAGGTTGTTATCCAGGATCCTGCA
GCAGATGATTCTGTCGATAGCTTGGCTGAGAAAACTGAAAGTTTGAcAGTTTCagATGGT
CTTGAGACAGCATTTTCTGGCAAAAAGAAGAAGAAGAAGCCTGTACACACTGATCTCTTG
AATGATGAGATGGATAATACAGGGGACGATATAGATGATCACTTCGGAGATGATGAAGAA
GCTGAAGAAATTGTTCTCCATCGCTATCCATGGGAAGGAAGTGACAGGGATTATGAATAT
GAGGAGCTTCtaggtcGTGTTTTCaaTATCCTTCGTGAAAATAATCCCGAGCTTGCTGGA
GACAggCGTAGaaCAGTAATGA