>JMCP015A06 276 bp,:Filtered
TTCATCGTCGGCCTGGAAGATAATCCGAAAGCATAACAAGTTTCGCTGCGTCAATTCGGA
GGTGCGGTCATGGCTGAAGAGGAAATCCAGAACGAGATGAAGGAGGAGGTTGCAGATATT
GCTCCATTTGATCCTACAAAAAAGAAAAAGAAGAAGAAGGTTGTTATCCAGGATCCTGCA
GCAGATGATTCTGTCGATAGCTTGGCTGAGAAAACTGAAAGTTTGACAGTTTCAGATGGT
CTTGAGACAGCATTTTCTGGC