>JMCP013H08 143 bp,:Filtered
ATGTTATTTGAAAGCTTGAATTCAGTGGCAGATAGAGAGGGTTGTTCACACGCGTAGCTG
CAGAGAGGCCTTGTGTTTCATGAGAACTGTAATCATAAACCCTGAATGAACGCTTAATTG
TATTTAATAaagTTCTTTGTTTC