>JMCP013G06 135 bp,:Filtered
TTGAAAGCTTGAATTCAGTGgaaGATAGAGAGGGTTGTTCACACGCGTAGcTGCAGAGAG
GCCTTGTGTTTCATGAGAACTGTAATCATAAACCCTGAATGAACGCTTAATTGTATTTAA
TAAAGTTCTTTGTTT