>JMCP013E05 239 bp,:Filtered
GAGCATTaggAGGTGcaGgACTGaagaAAAGTGGCAAGAAGTGATAAACTCGATGTTCAA
cgaAATCATTGAAAGACTTATTGTGGCAAGagcAATGCTCTTGcaTATGGTTGgtttaGA
TGTGTTGTTATaGATTGCATGTTTgaCTTCTCTAAGaCCTATCCTTCGTGAAACTGAAAG
AACATTTCTGCAATGCTGCCTTTGATTATGAAAGTTGTGTTGGTGTTGCTTAATGTCAA