>JMCP013E04 144 bp,:Filtered
AATGTTATTTGAAAGCTTGAATTCAGTGGCAGATAGAGAGGGTTGTTCACACGCGTAGCT
GCAGAGaGGCCTTGTGTTTCATGAGAACTGTAATCATAAACCCTGAATGAACGCTTAATT
GTATTTAATAAAGTTCTTTGTTTC